GSK-3β inhibitor TWS119 alleviates hypoxic-ischemic brain damage via a crosstalk with Wnt and Notch signaling pathways in neonatal rats
Limin Gao, Lijun Yang *, Hong Cui *
Department of Pediatrics, Beijing Friendship Hospital, Capital Medical University, No. 95 Yongan Road, Xicheng District, Beijing 100050, China

A R T I C L E I N F O

Keywords:
TWS119 GSK-3β
Hypoxic-ischemic brain damage Neonatal rats
Wnt signaling pathway Notch signaling pathway
A B S T R A C T

Preterm infant brain injury is a leading cause of morbidity and disability in survivors of preterm infants. Un- fortunately, the effective treatment remains absent. Recent evidence suggests that GSK-3β inhibitor TWS119 has a neuroprotective role in adult brain injury by activation of Wnt/β-catenin signaling pathway. However, the role on neonatal brain injury is not yet explored. The study aims to evaluate the effect of TWS119 at 7 d after hypoxic- ischemic brain damage and investigate the mechanism that it regulates Wnt and Notch signaling pathways at 24 h after hypoxic-ischemic brain damage in neonatal rats. Three-day-old rats were randomly divided into 3 groups: sham group, HI group and TWS119 group. The neonatal rats were subjected to left carotid artery ligation fol- lowed by 2 h of hypoxia (8.0% O2). A single dose of TWS119 (30 mg/kg) was intraperitoneally injected 20 min prior to hypoxia-ischemia (HI). At 7 d after HI, TWS119 improved the tissue structure, reduced cell apoptosis, up- regulated bcl-2 expression, up-regulated the expression of PSD-95 and Synapsin-1. At 24 h after HI, it activated Wnt/β-catenin signaling pathway by up-regulation of β-catenin protein expression and wnt3a/wnt5a/wnt7a mRNA expression. Simultaneously, it suppressed Notch signaling pathway by down-regulation of Notch1 and HES-1 proteins expression. Our study suggested that TWS119 performed a neuroprotective function at 7 d after hypoxic-ischemic brain damage via a crosstalk with Wnt/β-catenin and Notch signaling pathways at 24 h after hypoxic-ischemic brain damage in neonatal rats.

⦁ Introduction

Preterm infant brain injury is a leading cause of disability in survi- vors of preterm infants. It has been reported that 5–10% of preterm survivors may suffer from severe neurological disability, such as cere- bral palsy, and 25%-50% of survivors manifest with milder cognitive disabilities and behavioral problems (Back, 2015; Back 2017). It places economic burden on the society and family. Previous evidence suggests that neuron death (Zhu et al., 2003; Zhu et al., 2005; Thornton et al., 2017) and synaptic injury (Wang et al., 2018; Liu et al., 2019) are involved in the pathogenesis of Preterm infant brain injury. However, the specific mechanism is still unclear and the effective therapy is very limited.
The Wnt and Notch pathways are two of highly conserved signaling pathways with a crosstalk in development and diseases (Collu et al., 2014). Evidence suggests that the activation of the Wnt signaling pathway may play an important role in the neuroprotective response after hypoxic-ischemic brain damage by diverse protective mechanisms,
such as neurogenesis, neuroplasticity and angiogenesis (Lambert et al., 2016; Shruster et al., 2012; Sun et al., 2014). On the contrary, Notch signaling pathway is activated and plays a negative function in vivo and in vitro in hypoxic-ischemic brain damage (Xu et al., 2018). Evidence suggests that Notch pathway plays a role in neuronal apoptosis (Park et al., 2013). Moreover, Notch pathway interplays with other signaling pathways to induce cell death, such as Pin-1 (Baik et al., 2015) and p53 (Balaganapathy et al., 2018) pathways.
Evidence suggests that Wnt/β-catenin pathway is down-regulated by Glycogen synthase kinase-3β (GSK-3β) (Oliva et al., 2018), while Notch pathway is up-regulated by GSK-3β (Foltz et al., 2002). GSK-3β is a serine/threonine kinase and involved in the processes of neuronal plasticity and neurodegeneration (Jaworski et al., 2019). Inhibitors of GSK-3β perform a neuroprotective function on hypoxic-ischemic brain damage. Recently, TWS119, as one of GSK-3β inhibitors, plays an important neuroprotective role in adult stroke animal model by various mechanisms, such as anti-inflammatory activation (Song et al., 2019), attenuating hemorrhagic transformation (Wang et al., 2016), improving

Abbreviations: HI, hypoxia-ischemia; GSK-3β, glycogen synthase kinase-3β; NICD, Notch1 intracellular domain.
* Corresponding authors.
E-mail addresses: [email protected] (L. Yang), [email protected] (H. Cui).

https://doi.org/10.1016/j.brainres.2021.147588

Received 28 January 2021; Received in revised form 15 July 2021; Accepted 19 July 2021
Available online 24 July 2021
0006-8993/© 2021 Elsevier B.V. All rights reserved.

Fig. 1. TWS119 improves the tissue structure at 7 d after hypoxic-ischemic brain damage. Representative images in secondary visual cortex, mediolateral area (V2ML) of cortex and CA3 area of hippocampus by hematoxylin-eosin staining. The sham group shows that the normal neuron morphology, clear cytoplasm, and clear nucleus (A/D/G/J); the HI group shows the abnormal, disordered and loose neurons and the destroyed basic structure after HI (B/E/ H/K); TWS119 group shows the denser and ordered neuron arrange, normal neuron morphology, clear cytoplasm and nucleus (C/F/I/L). Black boxes represent increased magnification of selected cells as seen on the below side of
panel. (A/B/C/G/H/I, scale bar = 200 µm; D/E/F/J/K/L, scale bar = 50 µm).
the blood-brain barrier (Wang et al., 2017). However, the role on neonatal brain injury is yet not explored. GSK-3β inhibitor SB216763 modulates Wnt and Notch pathways to equilibrate neurogenesis and gliogenesis in a rat model of Parkinson’s disease (Singh et al., 2018). Whether TWS119 plays a protective role in hypoxic-ischemic brain damage via modulation of Wnt and Notch pathways is unclear.
the tissue structure at 7 d after hypoxic-ischemic brain damage.

⦁ TWS119 attenuates cell apoptosis at 7 d after hypoxic-ischemic brain damage
As shown in Fig. 2, it was found that the positive cells in cortex were significantly more in HI group compared with sham group (p < 0.0001),
=
=
=
=
=
while for TWS119 group the positive cells were significantly less compared with HI group (p 0.0021) (Fig. 2, A/B). The number of apoptotic cells in hippocampus also increased after HI (p 0.034). Compared with the HI group, the number of apoptotic cells in TWS119 group decreased (p 0.0442) (Fig. 2, C/D). Next, we further investi- gated the effects of TWS119 on apoptotic proteins bcl-2 and bax. We found that for HI group the expression level of bcl-2 significantly decreased compared with sham group (p 0.0457); for TWS119 group the expression level of bcl-2 significantly increased compared with HI group (p 0.0287) (Fig. 3, A/C). However, the expression level of bax was not changed significantly among sham and HI and TWS119 groups (Fig. 3, B/D). The ratio of bcl-2 and bax in HI group was lower compared with sham group and higher in TWS119 group compared with HI group (Fig. 3, E).
⦁ TWS119 up-regulates synaptic protein expression at 7 d after hypoxic-ischemic brain damage
= =
= =
Synapsin-1 and PSD-95 are the key presynaptic and postsynaptic proteins respectively. In this study, we found that the expression level of PSD-95 and Synapsin-1 decreased in HI group compared with sham group (PSD95: p 0.0126; Synapsin-1: p 0.0081). While both were significantly higher in TWS119 group compared with HI group (PSD95: p 0.0042 and Synapsin-1: p 0.0165) (Fig. 4, A/B/C/D). Next, we found that PSD95 was mainly observed in the soma and axons of pyra- midal neurons in cortex by immunohistochemistry. However, Synapsin- 1 was located in the cytoplasm of various neurons in the cortex. It also showed that staining of PSD-95 and Synapsin-1 decreased after HI and increased in TWS119 group (Fig. 4, E/F).
⦁ TWS119 activates Wnt signaling pathway at 24 h after hypoxic- ischemic brain damage
Next, we want to explore the mechanism of the protective effect on

Some evidence suggests that the rat brain at postnatal days 10 is
hypoxic-ischemic brain damage. Whether TWS119 activated Wnt

comparable to that of a term infant (Semple et al., 2013) which is the key period to assess brain maturation and injury of preterm infants (Duerden and Thompson, 2020). Therefore, in this study, postnatal day 10 (7 d after hypoxic-ischemic brain damage) is considered to assess the protective effect of TWS119 after hypoxic-ischemic brain damage. The aims of this study is to evaluate the neuroprotective effect of TWS119 at 7 d after hypoxic-ischemic brain damage and investigate the mechanism that it regulates Wnt and Notch signaling pathways at 24 h after hypoxic-ischemic brain damage in neonatal rats.
⦁ Results
⦁ TWS119 improves the tissue structure at 7 d after hypoxic-ischemic brain damage
As shown in Fig. 1, hematoxylin-eosin staining results revealed that the sham group had normal neuron morphology, clear cytoplasm, and uniform and clear nucleus in the cortex and hippocampus (Fig. 1, A/D/ G/J), while HI group exhibited abnormal, disordered and loose neurons arrangement, and Pyknotic neurons which were darkly stained pyknotic nuclei, cell body shrinkage, and intense eosinophilic cytoplasm (Fig. 1, B/E/H/K). Compared with HI group, TWS119 group showed the denser and ordered neuron arrange, normal neuron morphology, clear cyto- plasm and nucleus (Fig. 1, C/F/I/L). It indicated that TWS119 improves
signaling pathway and suppressed Notch signaling pathway? So we assessed the expression change of β-catenin, which is a key transcrip- tional factor in Wnt signaling pathway, and the upstream ligands wnt3a/
wnt5a/wnt7a. By Western-blot analysis, it showed that the β-catenin expression level was lower in HI group compared with sham group (p = 0.0116) and higher in TWS119 group compared with HI group (p = 0.01) (Fig. 5, A/B). By immunohistochemistry, it showed that β-catenin
= = =
stained in cytoplasm and nucleus. The staining in the nucleus was less after HI and deeper in TWS119 group (Fig. 5, C). We further investigated the expression of the upstream ligands wnt3a/wnt5a/wnt7a by RT-PCR. We found that the mRNA expression levels of wnt3a\wnt5a\wnt7a were less in HI group (wnt3a: p 0.0014, wnt5a: p 0.0012, wnt7a: p 0.0026), while TWS119 significantly up-regulated the expression of
wnt3a\wnt5a\wnt7a (wnt3a: p = 0.0108; wnt5a: p = 0.0183 and wnt7a: p = 0.0145) (Fig. 5, D).
2.4. TWS119 suppresses Notch signaling pathway at 24 h after hypoxic- ischemic brain damage
Next, we investigated the effect of TWS119 on Notch signaling pathway. This study assessed the expression of Notch1 intracellular domain (NICD), which is the activated factor of Notch1 and a key transcriptional factor in Notch signaling pathway, and the downstream transcriptional protein HES-1. We found that the protein expression of

Fig. 2. TWS119 reduces apoptosis at 7 d after hypoxic-ischemic brain damage. (A-B) Representative images and quantitative analysis of TUNEL staining positive cells in V2ML of cortex (scale bar = 100 µm). (C-D) Representative images and quantitative analysis of TUNEL label cells in CA3 of the hippocampus (scale bar = 100 µm). It shows that the positive cells were significantly increased after HI and were significantly decreased in TWS119 group. (one-way ANOVA test, * P < 0.05, ** P < 0.01, *** P < 0.0001).

=
=
=
=
=
= =
NICD and HES-1 was increased in HI group compared with sham group (NICD: p 0.0202 and HES-1: p 0.0166) and significantly decreased in TWS119 group compared with HI group (NICD: p 0.0224 and HES- 1: p 0.0261) (Fig. 6, A/B/C/D). Next, we investigated the mRNA expression of Notch1 and HES-1. The results showed that the mRNA expression of Notch1 was increased in HI group compared with sham group (p 0.008), but not significantly changed in TWS119 group compared with HI group (p 0.101); the mRNA expression of HES-1 was increased in HI group compared with sham group (p 0.013) and significantly decreased in TWS119 group compared with HI group
(p = 0.002) (Fig. 6, E/F).
⦁ Discussion

In this study, we found that TWS119, as one of inhibitors of GSK-3β, improved tissue structure, reduced cell apoptosis and increased synaptic protein expression at 7 d after hypoxic-ischemic brain damage. During our research, it simultaneously activated Wnt signaling pathway and suppressed Notch signaling pathway at 24 h after hypoxic-ischemic brain damage in neonatal rats.
Cell death plays an important role in hypoxic-ischemic brain dam- age, which can be divided into four forms: necrosis, apoptosis, nec- roptosis and autophagy (Thornton et al., 2017). Current studies found that apoptosis was the main mechanism in immature brain injury (Zhu et al., 2005). The apoptotic process is divided into the early acute injury stage and the late chronic repair stage. The delayed apoptosis which continues during a period of days to weeks mainly damages the in- terneurons and plays an important role in brain function recovery
(Lacaille et al., 2019; Tibrewal et al., 2018). Our study found that TWS119 improved the tissue structure at 7 d after hypoxic-ischemic brain damage. For the mechanism, our study further showed that TWS119 attenuated cell apoptosis. TDZD-8, another GSK-3β inhibitor, was reported that it also had a neuroprotective function by its anti- apoptotic activity in hypoxic-ischemic brain damage in neonatal mice (Huang et al., 2017). Previous studies showed that the mitochondria played an important role in apoptosis in the developing brain (Hagberg et al., 2009; Thornton and Hagberg, 2015). For the mechanism of apoptosis, our study found that TWS119 up-regulated the bcl-2 expres- sion and not affected the bax expression. One study showed that Notch signaling pathway induced neuronal apoptosis via the NF-kB and bcl-2 pathway in ischemic stroke (Arumugam et al., 2011). It indicated that bcl-2 was involved the anti-apoptotic process of TWS119 and was related to Notch signaling pathway.
A number of evidences showed that activation of Notch signaling pathway was involved in neuronal apoptosis in adult stroke animal model (Arumugam et al., 2018). Moreover, inhibition of Notch signaling pathway reduced neuronal apoptosis and enhanced neurogenesis by DAPT after stroke in neonatal rats (Li et al., 2016). Our study found that Notch signaling pathway was activated at 24 h after HI, while TWS119 inhibited Notch signaling pathway. Taken together, these finding indi- cated that TWS119 reduced cell apoptosis by the inhibition of Notch signaling pathway.
Some evidence found that expression level of wnt3a was down- regulated (Morris et al., 2007) and wnt3a could attenuated neuronal apoptosis in stroke animal model (Matei et al., 2018). Our study found that wnt3a and β-catenin expression was down-regulation at 24 h after

Fig. 3. TWS119 up-regulates the expression level of bcl-2 at 7 d after hypoxic-ischemic brain damage. (A-B) Representative western-blot analysis of bcl-2 and bax; (C-D) Quantitative analysis of bcl-2 and bax protein expression; (E) Representative the ratio of bcl-2/bax protein expression. It shows the expression level of bcl-2 significantly decreased after HI and increased significantly in TWS119 group; the expression level of bax was not changed significantly among sham and HI and
TWS119 groups; the ratio of bcl-2 and bax in HI group was lower after HI and higher in TWS119 group. The experiments were repeated at least three times. (one-way ANOVA test, * P < 0.05, ** P < 0.01).

HI, while TWS119 up-regulated the expression of wnt3a and β-catenin. Therefore, wnt3a might play a role to alleviate neuronal apoptosis. Our study found that TWS119 improved the tissue structure at 7 d after HI. Our finding indicated that TWS119 improved tissue structure and reduced cell apoptosis via a crosstalk of Wnt and Notch signaling pathways.
+
Synaptic connection plays an important role in brain development and is vulnerable to HI (Johnston et al., 2009). Previously, TWS119 was reported to up-regulate the expression of PSD-95 and synaptophysin at 21 d after stroke in adult animal model. Our study found that TWS119 increased the expression of PSD-95 and Synapsin-1 at 7 d after HI in neonatal rats. Moreover, we found that TWS119 reduced neuronal apoptosis and preserved neurons, which might lead to the upregulation of synaptic protein expression. Previous study showed that Wnt proteins modulated synaptic plasticity (McLeod and Salinas, 2018). One study found that wnt5a was essential for synaptic plasticity by increasing the expression of PSD-95 (Chen et al., 2017) and NMDARs (McQuate et al., 2017). Other study found that wnt7a promoted dendritic spine growth and synaptic strength by stimulating excitatory synapse formation and function (Ciani et al., 2011). In this study, we firstly found that TWS119 increased the mRNA expression of wnt3a/wnt5a/wnt7a at 24 h after hypoxic-ischemic brain damage. Collectively, TWS119 increased syn- aptic protein expression by up-regulation of wnt5a and wnt7a. However, previous studies showed that wnt5a and wnt7a regulated synaptic plasticity by non-classical Wnt pathway of Ca2 /Calmodulin-depen- dent protein kinase II (CaMKII) activity. Our study found that TWS119 activated classical Wnt/β-catenin pathway. Therefore, we speculated that both of pathways might simultaneously be involved to regulate synaptic plasticity by wnt5a and wnt7a. However, further research on the specific signaling pathway is needed.
In summary, GSK-3β inhibitor TWS119 alleviated apoptosis and increased synaptic protein expression at 7 d after hypoxic-ischemic brain damage via a crosstalk with Wnt and Notch signaling pathways at 24 h after hypoxic-ischemic brain damage in neonatal rats. This study provides a direction for the neuroprotective therapy of preterm infant
brain injury. GSK-3β inhibitor may become a new drug for brain pro- tection in the future.
⦁ Experimental procedures
⦁ Drug administration and experimental design

=
=
TWS119 (Sigma, SML 1271, dissolved in 1 % DMSO) was adminis- trated to the neonatal rats by intraperitoneal injection 20 min prior to HI procedure (30 mg/kg) (Wang et al., 2016). The neonatal rats were randomly divided into 3 groups: Sham group: sham-operated rats; HI group: rats were subjected to HI and vehicle (1% DMSO) treatment; TWS119 group: rats were subjected to HI and TWS119 treatment. The neonatal rats were decapitated at 7 d after HI for investigating the functions of TWS119 on tissue structure, cell apoptosis and synaptic proteins expression and 24 h post HI for assessing the mechanism that TWS119 regulated Wnt and Notch signaling pathways by hematoxylin- eosin, TUNEL staining, immunohistochemistry and western-blot and RT- PCR. The rats respectively were used for western-blot and RT-PCR (n 10 each group), and for paraffin section (n 5 each group) at 24 h and 7 d after HI. A total of 90 pups were used for this study and weight of 6.9–10.2 g regardless of gender.
⦁ Neonatal rat model of hypoxia-ischemic brain damage

Three-day-old Sprague-Dawley (SD) rats were submitted to the neonatal hypoxia-ischemic brain damage model, which mimics preterm infant brain injury (Stadlin et al., 2003). All protocols were carried out in compliance with the National Institutes of Health guide for the care and use of Laboratory animals. HI procedure was described previously (Zhang et al., 2020). Briefly, the rats were anesthetized and the left common carotid artery was isolated and ligated. Following the surgery, the rats were put back to the recovery cage with mother for a rest of 2 h. Then, the postoperative rats were placed in a hypoxic chamber (8%
oxygen + 92% nitrogen, 37 ◦C) for 2 h.

Fig. 4. TWS119 up-regulates synaptic protein expression at 7 d after hypoxic- ischemic brain damage. (A/B) Repre- sentative western-blot analysis of PSD95 and Synapsin-1; (C/D) Quanti- tative analysis of PSD95 and Synapsin- 1 protein expression. The experiments
were repeated at least three times (one-way ANOVA test, *P < 0.05, **P
< 0.01). It shows that the expression
level of PSD-95 and Synapsin-1 decreased after HI and were signifi- cantly higher in TWS119 group; (E) Representative images of coronal sec- tions labeled with PSD-95 in V2ML of cortex by immunohistochemistry. (E-
a/b/c, scale bar = 200 µm; E-d/e/f, scale bar = 50 µm); (F) Representative
images of coronal sections labeled with Synapsin-1 in V2ML of cortex. (F-
a/b/c, scale bar = 200 µm; E-d/e/f,
scale bar = 50 µm). Black boxes
represent increased magnification of selected cells as seen on the below side of panel.

⦁ Tissue process

The neonatal rats were used at 24 h and 7 d after HI procedure under the same conditions. The rats were anesthetized and cardiac perfused with 0.9% cold saline followed by 4% paraformaldehyde. Next, these rats were decapitated and the brains were removed into 4% para- formaldehyde for 24 h and were dehydrated with graded ethanol and vitrified by dimethylbenzene and embedded in paraffin. Then, the embedded tissues were serially sectioned into 5 µm coronal sections on a standard section, which displayed cortex, hippocampus and lateral

ventricular. These sections were used for hematoxylin-eosin staining and TUNEL staining and immunohistochemistry.

⦁ hematoxylin-eosin staining and TUNEL staining
The sections were baked at 75˚C for 30 min and dewaxed using xylene. Then, for HE staining, some sections were stained with hema- toxylin for 8 min, washed with water for 10 min, stained with eosin for 5 min, dehydrated with graded ethanol, cleared using xylene and mounted with neutral balsam. These images were capture with light microscopes.

Fig. 5. TWS119 activates Wnt signaling pathway at 24 h after hypoxic-ischemic brain damage. (A-B) Representative images and quantita- tive analysis of β-catenin by western- blot. The experiments were repeated at least three times. It shows that β-catenin expression level was lower after HI and higher in TWS119 group;
⦁ Representative images of β-catenin by immunohistochemistry. Black boxes represent increased magnifica- tion of selected cells as seen on the below side of panel. It shows that β-catenin stained in cytoplasm and nucleus. The staining in the nucleus
was less after HI and deeper in TWS119 group (C-a/b/c, scale bar = 200 µm; C-d/e/f, scale bar = 50 µm);
⦁ Quantitative analysis mRNA expression of wnt3a/wnt5a/wnt7a by
RT-PCR. (one-way ANOVA test, *P <
0.05, **P < 0.01). The data shows that
the mRNA expression levels of wnt3a
\wnt5a\wnt7a were less after HI and were significantly up-regulated in TWS119 group.

For TUNEL staining, some sections were incubated in TUNEL reaction mixture according to in site cell death detection kit instructions (Roche, Germany) at 37 ◦C for 1 h in a humidified chamber and then mounted
×
with DAPI containing medium. The sections for TUNEL staining were imaged at the same setting with 20 lens and five coronal slices per brain were imaged. The number of cells per field was quantified using Cell Counter plugin for Image J software (National institute of Health, Bethesda, MD, USA). This experiment is blinded.

⦁ Immunohistochemistry

Paraffin sections were dewaxed by dimethylbenzene and rehydrated by gradient alcohol and antigen repaired by citrate. Next, the procedures were complied with SP-Kit (ZSGB-Bio, SP-9000). Briefly, these sections were incubated with primary antibody: rabbit anti-β-catenin (1:400, 9562, cst), rabbit anti-PSD-95 (1:100, ab238135, abcam), rabbit anti-
Synapsin-1 (1:800, 5295, cst), overnight at 4 ◦C. Then, the secondary
antibody was goat anti-rabbit IgG conjugated to Biotin. These sections were visualized by staining with DAB and mounted on gelatin-coated slides.
⦁ Western blot analysis

The total protein was extracted from the left- brain tissue in ice-cold Radio Immunoprecipitation Assay buffer (Solarbio, China) and subse- quently, the protein concentration was determined using BCA assay. The samples were separated by SDS-polyacrylamide gel electrophoresis and transferred to PVDF membrane ((Millipore Corporation, USA). Sequentially, the membranes were blocked with 5%non-fat milk and incubated with primary antibody: rabbit anti-bax (1:1000, ab32503, abcam), rabbit anti-bcl-2 (1:500, ab194583, abcam), rabbit anti-β-cat- enin (1:1000, 9562, cst), rabbit anti-notch1 intracellular domain (NICD) (1:1000, 4147, cst), rabbit anti-HES-1 (1:1000, 11988, cst), mouse anti-
PSD-95 (1:000, ab2723, abcam) , rabbit anti-Synapsin-1 (1:1000, 5297, cst), rabbit anti-β-actin (1:3000, ab8227, abcam) overnight at 4 ◦C. The
+
membranes were incubated in the buffer containing goat anti-rabbit secondary antibody (1:4000, abcam) or goat anti-mouse secondary antibody (1:5000, gene-protein Link) for 1 h at room temperature. The pictures were taken by The ChemiDocTM XRS System (Bio-Rad, USA) and the quantitative analysis of each protein band was performed with the image Lab software. The experiments were repeated at least three times.

Fig. 6. TWS119 inhibits Notch signaling pathway at 24 h after hypoxic- ischemic brain damage. (A/B) Repre- sentative images of NICD and HES-1 by western-blot. (C/D) Quantitative anal- ysis of NICD and HES-1 protein expres- sion. The experiments were repeated at least three times. It shows that the pro- tein expression of NICD and HES-1 was increased after HI and significantly decreased in TWS119 group; (E/F) Quantitative analysis mRNA expression of Notch1 and HES-1 by RT-PCR. It shows that the mRNA expression level of HES-1 was increased after HI and significantly decreased in TWS119 group; the mRNA expression level of Notch1 was increased after HI and not
changed in TWS119 group. (one-way ANOVA test, *P < 0.05, **P < 0.01).

Table 1
Primers used for RT-PCR.
Gene Primer sequences 5′-3′

wnt3a F:GCAGCTGTGAAGTGAAGAC; R: GGTGTTTCTCTACCACCATCTC
wnt5a F:CTCGGGTGGCGACTTCCTCTCCG; R: CTATAACAACCTGGGCGAAGGAG wnt7a F:CGGACGCCATCATCGTCATA; R: GCTGTCTTATTGCAGGCACG
Notch1 F:GTGTGTGAAAAGCCCGTGTC R: GCACAAGGTTCTGGCAGTTG HES-1 F:AAACCCTCAACTGCTCCGTA; R: CACCGGGGACGAGGAATTTT β-actin F:CCCATCTATGAGGGTTACGC; R:TTTAATGTCACGCACGATTTC

⦁ RT-qPCR

Total RNA was isolated from the left cerebrum tissue with the pro- cedures of mRNA Isolation kit (QIAGEN, DP-419). Next, cDNA was synthesized from 1 µg of total RNA with PrimeScript™ RT reagent kit (Takara, Japan). The SYBR® Premix Ex Taq™ II (Takara, Cat#RR820, Japan) was used with Applied Biosystems 7500 Fast Real-Time PCR System. The data was analyzed with 2-ΔΔ CT. Primer sequences are shown in Table 1.
⦁ Statistical analysis

±
The statistical analysis was performed using statistical software SPSS20.0. Data was expressed as mean SEM. Multiple-group statistical
analysis was conducted using one-way ANOVA test. P < 0.05 was
considered statistically significant.
Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments

This work was supported by the National Natural Science Foundation of China (No. 81771622 to Hong Cui) and the Natural Science Foun- dation of Beijing Municipality (No. 7202035 to Lijun Yang).
References
Arumugam, T.V., Cheng, Y., Choi, Y., et al., 2011. Evidence that γ-Secretase-Mediated Notch Signaling Induces Neuronal Cell Death via the Nuclear Factor-κB-Bcl-2- Interacting Mediator of Cell Death Pathway in Ischemic Stroke. Mol. Pharmacol. 80, 23–31.
Arumugam, T.V., Baik, S., Balaganapathy, P., et al., 2018. Notch signaling and neuronal death in stroke. Prog. Neurobiol. 165–167, 103–116.
Back, S.A., 2015. Brain Injury in the Preterm Infant: New Horizons for Pathogenesis and
Prevention. Pediatr. Neurol. 53, 185–192.
Back, S.A., 2017. White matter injury in the preterm infant: pathology and mechanisms.
Acta Neuropathol. 134, 331–349.
Baik, S., Fane, M., Park, J.H., et al., 2015. Pin1 promotes neuronal death in stroke by
stabilizing Notch intracellular domain. Ann. Neurol. 77, 504–516.
Balaganapathy, P., Baik, S.H., Mallilankaraman, K., et al., 2018. Interplay between Notch
and p53 promotes neuronal cell death in ischemic stroke. J. Cereb. Blood Flow Metab. 38, 1781–1795.
Chen, C., Orefice, L.L., Chiu, S., et al., 2017. Wnt5a is essential for hippocampal dendritic maintenance and spatial learning and memory in adult mice. Proc. Natl. Acad. Sci. 114, E619–E628.

+
Ciani, L., Boyle, K.A., Dickins, E., et al., 2011. Wnt7a signaling promotes dendritic spine growth and synaptic strength through Ca2 /Calmodulin-dependent protein kinase
II. Proc. Natl. Acad. Sci. 108, 10732–10737.
Collu, G.M., Hidalgo-Sastre, A., Brennan, K., 2014. Wnt-Notch signalling crosstalk in development and disease. Cell. Mol. Life Sci. 71, 3553–3567.
Duerden, E.G., Thompson, D.K., 2020. Can you see what I see? Assessing brain
maturation and injury in preterm and term neonates. Brain. 143, 383–386.
Foltz, D.R., Santiago, M.C., Berechid, B.E., et al., 2002. Glycogen synthase kinase-3beta
modulates notch signaling and stability. Curr. Biol. 12, 1006–1011.
Hagberg, H., Mallard, C., Rousset, C.I., et al., 2009. Apoptotic Mechanisms in the Immature Brain: Involvement of Mitochondria. J. Child Neurol. 24, 1141–1146.
Huang, S., Wang, H., Turlova, E., et al., 2017. GSK-3βinhibitor TDZD-8 reduces neonatal hypoxic-ischemic brain injury in mice. CNS Neurosci. Ther. 23, 405–415.
Johnston, M.V., Ishida, A., Ishida, W.N., et al., 2009. Plasticity and injury in the developing brain. Brain Dev. 31, 1–10.
Jaworski, T., Banach-Kasper, E., Gralec, K., 2019. GSK-3beta at the Intersection of Neuronal Plasticity and Neurodegeneration. Neural Plast. 4209475.
Lambert, C., Cisternas, P., Inestrosa, N.C., 2016. Role of Wnt Signaling in Central
Nervous System Injury. Mol. Neurobiol. 53, 2297–2311.
Li, Z., Li, Z., Wang, J., et al., 2016. Acute Blockage of Notch Signaling by DAPT Induces
Neuroprotection and Neurogenesis in the Neonatal Rat Brain After Stroke. Transl Stroke Res 7, 132–140.
Liu, N., Tong, X., Huang, W., et al., 2019. Synaptic Injury in the Thalamus Accompanies
White Matter Injury in Hypoxia/Ischemia-Mediated Brain Injury in Neonatal Rats. Biomed Res. Int. 2019, 1–10.
Lacaille, H., Vacher, C.M., Bakalar, D., et al., 2019. Impaired interneuron development in a novel model of neonatal brain injury. eNeuro 6.
McLeod, F., Salinas, P.C., 2018. Wnt proteins as modulators of synaptic plasticity. Curr.
Opin. Neurobiol. 53, 90–95.
McQuate, A., Latorre-Esteves, E., Barria, A., 2017. A Wnt/Calcium Signaling Cascade Regulates Neuronal Excitability and Trafficking of NMDARs. Cell Rep. 21, 60–69.
Morris, D.C., Zhang, Z.G., Wang, Y., et al., 2007. Wnt expression in the adult rat
subventricular zone after stroke. Neurosci Lett. 418, 170–174.
Matei, N., Camara, J., McBride, D., Camara, R., Xu, N., Tang, J., Zhang, J.H., 2018.
Intranasal wnt3a Attenuates Neuronal Apoptosis through Frz1/PIWIL1a/FOXM1 Pathway in MCAO Rats. J. Neurosci. 38, 6787–6801.
Oliva, C.A., Montecinos-Oliva, C., Inestrosa, N.C, 2018. Wnt Signaling in the Central
Nervous System: New Insights in Health and Disease. Prog. Mol. Biol. Transl. Sci. 153, 81–130.
Park, J.S., Manzanero, S., Chang, J.W., et al., 2013. Calsenilin contributes to neuronal cell death in ischemic stroke. Brain Pathol. 23, 402–412.
Shruster, A., Ben-Zur, T., Melamed, E., et al., 2012. Wnt signaling enhances neurogenesis and improves neurological function after focal ischemic injury. PLoS ONE 7, e40843.

Song, D., Zhang, X., Chen, J., et al., 2019. Wnt canonical pathway activator TWS119 drives microglial anti-inflammatory activation and facilitates neurological recovery following experimental stroke. J Neuroinflammation. 16, 256.
Sun, F.L., Wang, W., Zuo, W., et al., 2014. Promoting neurogenesis via Wnt/beta-catenin signaling pathway accounts for the neurorestorative effects of morroniside against
cerebral ischemia injury. Eur. J. Pharmacol. 738, 214–221.
Singh, S., Mishra, A., Bharti, S., et al., 2018. Glycogen Synthase Kinase-3β Regulates Equilibrium Between Neurogenesis and Gliogenesis in Rat Model of Parkinson’s Disease: a Crosstalk with Wnt and Notch Signaling. Mol. Neurobiol. 55, 6500–6517.
Semple, B.D., Blomgren, K., Gimlin, K., et al., 2013. Brain development in rodents and humans: Identifying benchmarks of maturation and vulnerability to injury across
species. Prog. Neurobiol. 106–107, 1–16.
Stadlin, A., James, A., Fiscus, R., et al., 2003. Development of a postnatal 3-day-old rat
model of mild hypoxic-ischemic brain injury. Brain Res. 993, 101–110.
Thornton, C., Hagberg, H., 2015. Role of mitochondria in apoptotic and necroptotic cell
death in the developing brain. Clin. Chim. Acta 451, 35–38.
Thornton, C., Leaw, B., Mallard, C., et al., 2017. Cell Death in the Developing Brain after Hypoxia-Ischemia. Front. Cell. Neurosci. 11.
Tibrewal, M., Cheng, B., Dohare, P., et al., 2018. Disruption of Interneuron Neurogenesis in Premature Newborns and Reversal with Estrogen Treatment. J. Neurosci. 38,
1100–1113.
Wang, W., Li, M., Wang, Y., et al., 2016. GSK-3beta inhibitor TWS119 attenuates rtPA- induced hemorrhagic transformation and activates the Wnt/beta-catenin signaling
pathway after acute ischemic stroke in rats. Mol. Neurobiol. 53, 7028–7036.
Wang, W., Li, M., Wang, Y., et al., 2017. GSK-3beta as a target for protection against
transient cerebral ischemia. Int J Med Sci. 14, 333–339.
Wang, F., Yang, Y., Yang, N., et al., 2018. Enhancing oligodendrocyte myelination
rescues synaptic loss and improves functional recovery after chronic hypoxia. Neuron. 99, 689–701.
Xu, Z., Xu, L., Wang, J., et al., 2018. Expression changes of the notch signaling pathway
of PC12 cells after oxygen glucose deprivation. Int. J. Biol. Macromol. 118, 1984–1988.
Zhu, C., Qiu, L., Wang, L., et al., 2003. Involvement of apoptosis-inducing factor in neuronal death after hypoxia-ischemia in the neonatal rat brain. J. Neurochem. 86,
306–317.
Zhu, C., Wang, X., Xu, F., et al., 2005. The influence of age on apoptotic and other mechanisms of cell death after cerebral hypoxia–ischemia. Cell Death Differ. 12,
162–176.
Zhang, N., Yang, L., Meng, L., et al., 2020. Inhibition of miR-200b-3p alleviates hypoxia- ischemic brain damage via targeting Slit2 in neonatal rats. Biochem. Biophys. Res. Commun. 523, 931–938.